SubtiBank SubtiBank
Version comparison:

2018-01-03 17:25:542017-8-11 16:0:3

Biological materials

Mutant

MGNA-B132 (yloN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1131 NBRP B. subtilis, Japan]

1A819 ( ''yloN''::''erm''), [Pubmed|12682299], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A819&Search=1A819 BGSC]

BKE15750 (Δ[[gene|yloN]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTATTAAGTTCTGCCA, downstream forward: _UP4_CAAGACGAGACGAGGTGATG

BKK15750 (Δ[[gene|yloN]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTATTAAGTTCTGCCA, downstream forward: _UP4_CAAGACGAGACGAGGTGATG

MGNA-B132 (yloN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1131 NBRP B. subtilis, Japan]

1A819 ( ''yloN''::''erm''), [Pubmed|12682299], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A819&Search=1A819 BGSC]

_ec